We hear all the time how crazy it is that Michael and I are both carriers of a mutation on the same gene. We get it. It blows our minds as well. For our children to be affected, they have to receive both of our bad copies, so there is a 75% chance our child isn't born blind or visually impaired. Presley obviously falls into the 25%. In families where multiple kids are affected, the severity of the visual impairment tends to vary. FEVR (which is what Presley has been diagnosed with) also typically isn't complete blindness from birth. We're very rare. And Presley is extra special.

Below are each of our mutations. The parts in bold are what it should be (referen) and then where our DNA went wrong.

Variant in mom and child:

referen: TGGACGGGCAGTTCCGGCAAGTCCTCGTGTG

patient: TGGACGGGCAGTTCCTGCAAGTCCTCGTGTG

Variant in dad and child

referen: CCTCCCCCAGAGCCGCCCACCTGCTCCCCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTATCCCCGGGGCCTGG

patient: CCTCCCCCAGAGCCGCCCACCTGCTCCCCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTGCCCACCTGCTCCCCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTATCCCCGGGGCCTGG

As you can see in mine, it is simply a T instead of a G. That's it! Crazy, right? Michael has a duplication where a segment of the gene repeats itself. Because Presley received both of our mutations, it caused the gene to lose its function, which resulted in her unexpectedly being born blind.

But, God makes no mistakes. He made no mistake in Presley, and He made no mistake in bringing Michael and I together. I've unfortunately (and shockingly) been asked more than once if we regret marrying each other. You know, since if we married anyone else, our child would not be born blind. To be clear, he's the greatest husband and father I could have ever asked for, and I was one of those girls that dreamed about this at an early age. I didn't have a boyfriend all of college. I had no interest in dating just to date, and I could tell upon meeting someone if there was something there or not. Little did I know, my guy was hanging out in Abilene, Texas at the time. When we met in late 2012 in Dallas through mutual friends, I knew pretty quickly he was the one...if I was lucky enough to have him choose me.

The world needs more Michaels. He's carried his family on his back through times when most men would crumble. He fiercely loves and protects us. He's the kind of man that will do anything for his friends. The world needs to know that humble, noble men exist. Presley and I are lucky enough to have a front row seat.

I've been believing for miracles since Presley was diagnosed, because my God is the same God who parted the Red Sea and made the walls of Jericho crumble. Sometimes His game plan seems crazy.... march around the walls of Jericho how many times?! But, I believe His ways can be trusted, so I'm going to keep believing the impossible. And maybe that's a little crazy, but I'm okay with that.