Time

Time. We live in minutes, hours, days, and weeks. We can't see it. We can't control it. There’s no pause button and no way to rewind it.

This post is about managing your time, making it count, and being happy with your choices.

This post is about living a little and loving a lot. 

This post is a friendly reminder to look at the time and look at your family.  

Our parents won’t be around forever (those that have lost theirs can painfully attest). Call them or spend vacation with them (personal favorite!)

Your family and friends are everything-not that flawless body that you're chasing (it will not make you more lovable). Kill it in the gym, but have the balance to know when to go home, when to skip, when to prioritize your family over your vanity. 

Your children will not always be little or just a room away. Put your phone down, listen, and engage.

Work hard at your job, but rest hard as well. Take your family on vacation. Make memories with your children. Take ALL the pictures and videos.   

Forgive quickly, even if forgiveness is never asked. (Talking to myself here-I struggle with this)

Encourage when you have the opportunity.  

Save your money, but know when to invest it or splurge on the ones you love. My hubby keeps me grounded here...I splurge more than I save💁🏼‍♀️Buuut he is a sucker for surprising Presley with new toys just because.

Hang in there on the hard days. I’ve learned one of the most healing things is allowing yourself to feel the pain grief brings. Don’t always set it aside. I know it’s tempting. Sometimes a good cry is all you need.   

No day is meaningless, no kind word wasted.

Live for today. Not for the future. I will never give up hope for Presley to be able to see one day, but I also truly am okay if she doesn’t. Time heals.

Love your neighbor. Even when you disagree with them.  

Believe in our country. That even when we cannot see it. There’s light to be found. 

I’m certainly no expert-just an ordinary mom given a rare opportunity to view life through a different lens.

I am so proud of the little girl Presley is becoming, and the light that she shines, and the things that she is teaching her incredibly flawed mom.

Time is ticking. Make it count.

📷: Jess Barfield  

“Claire’s here!”

Claire Kathryn Halbert joined our family on Wednesday, August 29 at 6:42pm weighing 7lbs. 13oz. and 18 inches long. I’m convinced that life has never been sweeter.

Whenever people are around that Presley knows, she announces who is here: “Daddy’s here! Hudson’s here! Minnie’s here! Bubba’s here!” Etc. Michael’s thoughtful and creative sister, Kristen Barstad, made t-shirts for our families for the big day which said, “Claire’s here!” Inspired by Presley of course. Claire came out after only two pushes, but it took a little bit before our families were able to come back to Labor & Delivery, which we felt so bad about, until we saw how much fun Presley and the Barstad and Spring kids were having in the waiting room. My sister’s almost three year old left saying that was such a fun treat! (After he said, “Cici, you squeezed her out? Good job!!”😂) Who knew a hospital waiting room could be so fun? 

Legitimately looked like Presley’s twin when she first came out!

On Tuesday, we went to see our local Retina Specialist in Dallas to have Claire’s eyes checked. We got a red reflex in both eyes in the hospital, which was very encouraging because we didn’t with Presley, but a red reflex only rules out complete retinal detachment so we still needed to see a Retina Specialist to know if she was affected or showing any symptoms since it can vary greatly even among family members. While he made us very nervous during a thorough exam, when he finally talked, he told us Claire can definitely see and her eyes look normal! Tears, chills, and more tears. He wants to check her again in four months before he gives us the all clear, but we are so, so thankful for this news! While it would have been a different experience this time around had we been given different news, we of course want our babies to be able to see and we are thankful for healthy eyes! It makes me cry. Like the happiest tears.

Presley is already taking on the role of big sis and says “it’s okay Claire bear” when she cries and tells her she loves her. My hormones can’t handle it. Being one of four girls and very close with all of my sisters, I know firsthand how special sisters are, and I cannot wait to see these two become the best of friends. You are both a dream come true my precious daughters. Your dad and I will always be here for you and we will love you endlessly.

Two

Two years old. 

When I sit here and think about the last two years, I am in awe of how much my family has changed. I am in awe of who we've become. Two years of absolute, unconditional love for the tiny human who changed our lives. 

She is spunky and loving, demanding and opinionated. She loves to sing songs, go on car rides, swing on her swing, jump, and make “silly noises.” She started pre-school twice a week for three hours this month and talks about it all the time. Hearing her talk about her teachers, friends, and activities at school will melt your heart. She continues to amaze us with how easily she picks things up and adapts. She doesn't know yet that she's unique, but I hope she learns to love it when she realizes how rare she is. I hope she knows that different isn't scary and the features of your frame are nothing compared to the contents of your heart.

Happy 2nd birthday to our sweet P! You are loved more than you could ever know.  

Faith

"We walk by faith, not by sight." 2 Corinthians 5:7

As Christians, we are called to live by faith; an attitude of complete trust in God. Something that is so simple to say, yet can be hard to live by. So often I find that it is so easy for Christians to share about how God redeemed them and showed His grace after they've gone through a hard season. But, how hard is it to live by faith when you are in the middle of the storm? I've been reflecting on this as we are at the one year anniversary of Presley's last eye surgeries. We have come so far in a year, and I can only thank the Lord for bringing us through some of the toughest days of our life. 

Surgery days were hard, even with the most caring and skilled of doctors in the world. After Presley's 5th eye surgery last year, I started crying when I got to hold her-like I did every time. I will never forget the nurse looking at me and saying, "Oh sweetie, I thought you've been through this before." Seeing your innocent baby groggy with a patch over her eye and likely in some discomfort is never easy no matter if you've been through it before or not. Sometimes I wish I could just slap people across the face, but instead I took the passive aggressive route and just ignored her. Michael handles the insensitive and hurtful comments much better than I do. I’m learning from him but am definitely a work in progress still. I know people don’t mean to be malicious but the ignorance can be gut-wrenching. 

I've learned my whole life about Jesus Christ and His atonement but for the first time in my life all that I had learned and believed was being put to the test. Did I really believe? Did He really suffer for me and feel all my pain? Could the atonement really heal my broken heart? 

Let's be honest-some seasons just suck. They are the worst. They hurt like hell and there is no way around it. But, other seasons are so incredibly hard and yet, hard does not always equal bad. Times can be hard and also good. 

A difficult workout is not necessarily bad. Hard work, a rough patch in a relationship, a time of feeling lonely are not always bad. They may seem bad at the time, but getting it done and pressing on will bring good results out of a time of exhaustion.

I believe that my seasons of "hard" have and will continue to be (as they are far from over) an opportunity to live out what I say I believe. God is the one and only source of true joy and peace. He has healed my broken heart. I have a smile on my face because of the gift He has given me in Presley and the precious life growing in me. He has shown me how to choose faith over fear day after day, which isn’t always easy for me especially being pregnant again and all the worry that comes with that. We've all heard the expression, "I'll believe it when I see it." But you can't see faith. Walking by faith and not by sight requires you to go to a place you do not know, one that God will reveal as you walk in obedience with Him. Walking by faith requires you to follow God’s plan regardless of what life throws at you. And life will throw you curveballs. I have a hard time when I hear people planning out every second of their future or their kid’s future like everything will happen and fit their perfect timeline and picture of their life. I’m not saying don’t plan. I still plan, but I now plan knowing that these are just my plans. God may have something different in store, and I want to be willing and ready to accept that. 

Being Presley's mom is my greatest accomplishment. People ask us a lot how we've known what to do and the best ways to help her, and I always say she's our daughter. Just like any new parent, you learn your child and his/her needs and it just comes naturally. Well, for the most part. In those first few months after she was born and we found out she was blind, Michael and I talked a lot about how we need to be really good at explaining everything to her and talking to her all the time. I was thinking okay God, I can think of a lot of people who would be better parents of a blind child than us! I've never been known as a talker. Of course, talking to your child is a little different than being the most outgoing person, but you get the point. I got asked to speak at a Rare Disease Conference this summer and just the thought of public speaking is enough to make me start sweating. I’ve always been better at expressing my thoughts in writing. I won’t say that I won’t ever do that because I don’t know what doors God is going to continue to open for me regarding nonprofit work and raising awareness in the future, but for now, I am just going to stick to my Apple products. #notsponsored

From early on, I started making it a habit of describing everything to her no matter where we were or how simple the task was. Just because she can't see doesn't mean that she is going to miss out on those details that a sighted child picks up on from simply turning their head and looking or watching. When Michael goes to shower before work in the morning, he takes her with him and she helps him turn on the shower. It can be simple things, but it’s important to us that we include her in everything we do and let her explore with her hands whenever applicable. We want her to experience everything like her sighted peers. She just may experience it in a different way. She lives in a sighted world. We want her to understand the world around her. 

She is already proving how smart she is and that she has been listening to us all along. She’s a little sponge. There can be a room full of people talking and someone goes to get ice and Presley will say, "ice, ice." We've even had to stop a few times and be like why is she saying that? Oh, because Lauren just got up to get ice, etc. etc. She hears the garage opening in the evenings and screams, "daddy's home, daddy's home!!" (He's literally her favorite person ever—not bitter about it). She knows the entire ABCs. She knows all the farm animal sounds. She identifies her body parts. She can count to 20-she is only 20 months old by the way. She recognizes people's voices already. She identifies things she touches. She is learning the layout of our house. Her spatial awareness is incredible. Sometimes she could fool you because she will put her hand out to touch the wall at just the right time like she saw it. Today we got in the elevator at the mall and she immediately said, “ding, ding” like the sound it makes when you get to your floor. She recognizes songs within a second. You can often find her requesting “Jackson.” Yes, a Michael Jackson fan she is-specifically Thriller and Beat It. If you ask her what she wants for lunch, she will most definitely say “quesadilla.” She even woke up one morning last week yelling, “quesadilla, quesadilla” in her crib.😂 She may be a daddy’s girl but she got my love for Tex-Mex. She is high maintenance and stubborn at times, but oh so freaking adorable, and we are enjoying every second with her. 

We went for a follow-up appointment at Texas Retina here in Dallas in March and will go back again at the beginning of September. At this point, we are just monitoring and making sure her eyes remain stable post surgeries. The only true way to know what her retinas look like is to do an Evaluation Under Anesthesia and we are all in agreement that isn’t necessary at this point. Michael and I do not want to have to put her under anesthesia again unless there is a medical reason to do so. After our last surgery on May 3 last year, Dr. Capone told us he had done everything he could from a surgical standpoint and it was up to her eyes to do the work from here. From what Dr. Abbey can see from looking in her eyes, her retinas are still settling back slowly (which is what we want) but we feel she is developing so well otherwise, we're not as concerned with what she might or might not be able to see. No matter what, she is considered blind. She will read braille and walk with a cane. We have hope that she will see within her lifetime, but our focus now is on giving her all the tools she needs to be successful and just treating her like any other kid. 

Thank you all for caring, loving her, and supporting us like you have. We are truly grateful. We love our little mountain mover! 

“Never let anyone tell you what you can’t do...prove ‘em wrong.”

— Shaquem Griffin

Crazy

We hear all the time how crazy it is that Michael and I are both carriers of a mutation on the same gene. We get it. It blows our minds as well. For our children to be affected, they have to receive both of our bad copies, so there is a 75% chance our child isn't born blind or visually impaired. Presley obviously falls into the 25%. In families where multiple kids are affected, the severity of the visual impairment tends to vary. FEVR (which is what Presley has been diagnosed with) also typically isn't complete blindness from birth. We're very rare. And Presley is extra special.

Below are each of our mutations. The parts in bold are what it should be (referen) and then where our DNA went wrong. 

Variant in mom and child: 

referen: TGGACGGGCAGTTCCGGCAAGTCCTCGTGTG

patient: TGGACGGGCAGTTCCTGCAAGTCCTCGTGTG

Variant in dad and child

referen: CCTCCCCCAGAGCCGCCCACCTGCTCCCCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTATCCCCGGGGCCTGG

patient: CCTCCCCCAGAGCCGCCCACCTGCTCCCCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTGCCCACCTGCTCCCCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTATCCCCGGGGCCTGG

As you can see in mine, it is simply a T instead of a G. That's it! Crazy, right? Michael has a duplication where a segment of the gene repeats itself. Because Presley received both of our mutations, it caused the gene to lose its function, which resulted in her unexpectedly being born blind.

But, God makes no mistakes. He made no mistake in Presley, and He made no mistake in bringing Michael and I together. I've unfortunately (and shockingly) been asked more than once if we regret marrying each other. You know, since if we married anyone else, our child would not be born blind. To be clear, he's the greatest husband and father I could have ever asked for, and I was one of those girls that dreamed about this at an early age. I didn't have a boyfriend all of college. I had no interest in dating just to date, and I could tell upon meeting someone if there was something there or not. Little did I know, my guy was hanging out in Abilene, Texas at the time. When we met in late 2012 in Dallas through mutual friends, I knew pretty quickly he was the one...if I was lucky enough to have him choose me. 

The world needs more Michaels. He's carried his family on his back through times when most men would crumble. He fiercely loves and protects us. He's the kind of man that will do anything for his friends. The world needs to know that humble, noble men exist. Presley and I are lucky enough to have a front row seat. 

I've been believing for miracles since Presley was diagnosed, because my God is the same God who parted the Red Sea and made the walls of Jericho crumble. Sometimes His game plan seems crazy.... march around the walls of Jericho how many times?! But, I believe His ways can be trusted, so I'm going to keep believing the impossible. And maybe that's a little crazy, but I'm okay with that. 

One

One year. It's been 12 months since the most precious gift was placed in my arms. She came on her own time 7 days late, despite me trying everything in the book to get her to come sooner. After 20 minutes of pushing on Friday, August 26, 2016, Michael and I came face to face with a love that we had never experienced before. There are absolutely no words for the moment you hold your baby for the first time and become parents. 

Six surgeries in Detroit. A move for better services. New friends. An incredible support system. An unexpected journey. One loving God. 

One year of learning to live one day at a time. One year of searching for meaning. One year of learning to loosen my grip and let God. One year of finding that Hope is the only thing to hold on to. One year of discovering that I was strong enough to carry weight that I'd never before considered carrying. One year of surviving, growing, and thriving. One year of finding joy even in the hardest of times. 

One year of Presley. One year of her adorable and dainty self. She's cautious but determined. Stubborn but lovable. She loves to be held just don't sit still. She loves to be sung to and is quite forgiving on tone (mom can't hold a tune). She has a smile that will light up a room. She's the kind of different that makes you look twice and the kind of sweet that makes you melt into a puddle. She's our everything. 

One challenging, incredible, beautiful year of Presley. Here's to many, many more!

*Huge thank you to Paige Gilbert for joining us to take pictures. I will cherish these (and all the others) forever. Here's a glimpse into the most perfect day celebrating the most perfect one year old. 

And for a few of the most thoughtful, beautiful gifts. Beyond thankful for the hearts behind these. 

Michael's best friend since childhood, Austin Vick, had my blog (Vol 1) printed in Braille so Presley will have her own hard copy to read when she's older.😭What an i n c r e d i b l e friend.

Sensory board from the Spring family. Personally made by my brother-in-law, Ryan.

My neighbor's three year old daughter, Kambri Hammer, made Presley a multiple page tactile card.

Perspective

Life is all about perspective. That in itself carries so much power. When we first got my daughter's diagnosis, my hopes and dreams of what my family was going to look like suddenly vanished in a split second. I felt robbed. I remember crying in my bedroom with my sisters while I was nursing and feeling completely helpless and lost. Not only was I a new mom, but my baby was just given a diagnosis that I could not wrap my head around. Blind? How could this happen? I've never known anyone to be blind let alone a child. Why my baby? Why us? Were we being punished? While I certainly had made mistakes, I had always tried to be a good person. I was involved in community service, attended church, didn't drink until I was 21, saved myself for marriage. I took the pregnancy guidelines to the extreme and cut out completely all deli meat, soft cheeses, alcohol, caffeine...not one Dr. Pepper people for 9 months! I took care of my body and exercised. I had done everything "right." We've seen people make different life choices and have a healthy, typically developing child. Why would God let this happen? This perspective weighed heavily on me.

The blessing of perspective is that we have a choice in how we view things. When we change the way we view a situation, we change the way we feel about it. 

I wish I could give August 2016 Caroline a hug. I wish I could tell her that God was leading her down an unexpected path but one filled with more love and joy than she ever could have dreamed of. I wish I could tell her that her life was going to be pretty normal and that she's stronger than she ever realized. I wish I could tell her how much happiness that baby was going to bring day in and day out.

God had prepared me for this point in my life. He had equipped me to be the mom of my perfect Presley. I can now look back on my life and see how God was molding my heart and building my community of support that I had no idea I would need years later (other than my own family who I could write a novel about...more on each of them at a later date).

I've mentioned before that I went to Trinity Christian Academy from K-12 grade. I spent 13 years at TCA. It was there that an introverted girl found her way. I was able to make mistakes, learn, and grow in a Christ-centered environment. TCA helped shape me to be the person that I am today (and also made me the wordy writer that I am🤷🏼‍♀️thank you history/english essay tests). TCA helped prepare me for this journey. It's not just a school; it is a family. I've always known this to be true but I experienced it in its truest form when I came face to face with the unimaginable. I know TCA is not for everyone, but it was home for me.

God has been opening doors since the day we found out Presley was blind. When I began to choose joy, I started to see our purpose more clearly. I may never know the "why" on this side of heaven, but I am vowing to take the lessons that God is teaching me from this and turn it into good.

When I changed my perspective, it changed everything. 

At first, we just wanted a fix. Of course we did. But now that we have educated ourselves on the blind community, our perspective has changed. Do we still wish Presley could see? A thousand times yes. But we have seen that many blind people are living happy, fulfilled, independent lives. They are capable. It's the sighted world that we live in that tells them they can't do something or feels sorry for them. Shame on us. My brother-in-law, Ryan Spring (who also started teaching himself Braille right after we got the diagnosis) read Seeing Home: The Ed Lucas Story and then recommended it and passed it on to us. We're so thankful he did. Ed Lucas was an Emmy-winning blind broadcaster who refused to let his blindness stop him from reaching his dreams. As Ed says, "I never viewed my blindness as a disability, just an inconvenience." Powerful. Blind is not going to be a word we shun from using. It is a part of Presley, but it does not define her. I believe in my daughter: blind or not. 

Michael and I knew pretty early on we wanted to start a nonprofit. We didn't know exactly what it was going to look like, but we knew we wanted to help other families and raise money for research. The impact that a nonprofit can have on families searching for hope and answers is immeasurable. Instead of saying why us? I now find myself saying why not us? Not long after we moved to Frisco, I looked at Michael and said, "we're going to cure blindness." He gave me that look like, pump the brakes, blondie. Curing blindness, especially congenital blindness, is a tall, tall order. Absolutely. But we have the resources, we have the passion, we have the ability to make a difference. There is promising research taking place, and we will be a part of that conversation! We have hope.

I've connected with lots of moms already who just found me through social media. About a month before we went for our last round of surgeries, we began brainstorming and figuring out how we were going to implement our nonprofit. Because there are so many different eye diseases that can lead to blindness and eyes are so complex, knowing the right places to donate to isn't so easy though. I knew that I wanted to help other families, but I also felt strongly that we had to be a part of continuing the research that is taking place. Enter Dr. Capone.

When we were waiting in pre-op for Presley's first surgery in April, Dr. Capone came by as he usually does to go over a few things before they took her back. I kind of get that feeling like a celebrity just walked through the door when he enters. He's the man...in case you hadn't heard already. We went over what the plan was and then he began telling us about his nonprofit that he and his partner, Dr. Trese, had founded. The mission of their foundation is to help families going through exactly what we were going through and to raise funds for research. They base their science work in a 2+million dollar molecular genetics lab on the campus of Oakland University that they built with independent donor contributions. Even with all the research we had done, which Dr. Capone has always told us he can tell we know our stuff by the questions we ask, we never came across this nonprofit. We had no clue this even existed. He told us they were in the process of revising the organization, and he wanted to see if we would be interested in joining forces with him. He said that from getting to know us he thought we would be the perfect fit. While the board had previously been made up of primarily doctors in their practice, he said that they could benefit from having a family who has been affected personally by a retinal disease on their team: a family that can connect families, relate, provide support, give expectations for surgeries: a family that has the passion to raise funds for research because their child could potentially benefit from it. He also acknowledged they didn't have a very strong social media presence. (I know someone that could surely help with that!🙋🏼) My jaw was on the floor...as my thighs were burning from doing squats to keep my hungry baby from crying. God is so good. We're just getting our feet wet, but we're so excited for what is to come. Stay tuned!

Michael and I are walking, sometimes stumbling, on this path as obediently as we can. Bad things will happen in your life. Pain is inevitable. Everyone is struggling with something whether they want you to see it or not. Everyone has a story. By sharing our story, we hope we can help someone else find their hope and their purpose. 

I'll leave you with a song I've listened to every day since probably October and rarely get through it without crying. Sean Mcconnell's "A Beautiful Rose." There is a lesson in the pain; a beautiful rose in the thorn bush. Presley, you are our Beautiful Rose.

Just Be Held

Hold it all together
Everybody needs you strong
But life hits you out of nowhere
And barely leaves you holding on

And when you're tired of fighting
Chained by your control
There's freedom in surrender
Lay it down and let it go

So when you're on your knees and answers seem so far away
You're not alone, stop holding on and just be held
Your world's not falling apart, it's falling into place
I'm on the throne, stop holding on and just be held
Just be held, just be held

If your eyes are on the storm
You'll wonder if I love you still
But if your eyes are on the cross
You'll know I always have and I always will

And not a tear is wasted
In time, you'll understand
I'm painting beauty with the ashes
Your life is in My hands

Have you ever wondered how you would react to a devastating diagnosis? Or maybe you already have. You never think it will happen to you, and then it does. Even though today may be bad, God is still good. God doesn't promise us a pain free life; a life without struggles or heartbreak. Loved ones get sick. Failure, infertility, rejection, marital issues, financial stress happen. Definitions of "normal" change. However, God does promise that we never have to face these obstacles alone. He is with us every step of the way; even when it doesn't go how we want it to. 

I've always prided myself on having things under control; on being independent. I'm a planner to my core. I don't like feeling helpless. I do and do and do to avoid feeling helpless. Yet, here I find myself. This was not a part of my plan. There is nothing I can do to give Presley sight (and trust me, I asked if eye or retina transplants were a thing because I would have signed up yesterday if I could give her mine). All I can do is trust in God. Trust in God's purpose for Presley and His purpose for our family. God is the God of the impossible. We've already seen Him perform a miracle. It's a good thing He specializes in those. I know You don't work on my timeline, Lord, so I'll just be here being held by You in the meantime.  

P.S. Tomorrow would be a good day for another miracle. Just sayin'. 💁🏼 #Detroitbound

“When you pass through the waters, I will be with you; And through the rivers, they will not overflow you. When you walk through the fire, you will not be scorched. Nor will the flame burn you. For I am the Lord your God, The Holy One of Israel, your Savior. ”

— Isaiah 43:2-3

Detroit Surgeries

I've had a lot of people ask me about the details of Presley's surgeries so I thought I'd go ahead and explain them here for everyone. We know we have prayer warriors far and wide; some that know us personally and others that do not. We are humbled and grateful. 

To backtrack a little since we now have a better understanding of Presley eyes, her retinas (the light-sensitive tissues at the back of the eyes which are essential for sight) were completely detached and crumpled up at birth as a result of an ultra-rare mutation. Michael and I now know we are both carriers of the LRP5 mutation and, together, we created a baby who we've recently learned is actually more like 1 in 50 million. I think for the rest of our lives we will ask ourselves how we could be so rare.

Taking you back to biology class, our bodies all have recessive genes; meaning they aren't showing or affecting us. For example, I have blonde hair so I could have received one gene for brown hair, which is recessive, and one gene for blonde hair, which is dominant. Michael and I both have 20/20 vision so FEVR is recessive in us, because we received one good copy of LRP5 from one of our parents. Right now, mutations in five genes are known to be associated with FEVR. It is very uncommon to match up with someone who also has a mutation on the exact same gene which is what makes these diseases so rare. Our bodies will naturally choose the better copy hence why Michael and I aren't blind and why the majority of people aren't born with hereditary disabilities. In Presley's case, she received two non-working LRP5 genes resulting in her being blind. Why she was born blind and hers is more severe than normal LRP5 FEVR cases, we have no clue. Dr. Capone's office is doing a study and paper on us. Because we both have to pass down our bad copy for it to affect the eyes, there is a 25% chance our future kids could have FEVR. 

Since the mutation presented itself in utero, her eyes didn't stand a chance. Everything in her eyes was pushed forward and an excessive amount of scar tissue formed at the back of the eyes. She has had a vitrectomy on each eye twice (not laser surgeries). Because of the damage, Dr. Capone has to go through the front of the eyes. He had to remove the lens in both eyes in the first surgeries. With each surgery, he has had to take more and more of the iris so those pretty blue eyes are no longer blue. In every surgery, he is trying to safely remove as much scar tissue and drain as much dried blood as he possibly can to ideally allow her retinas to open and sink back and ultimately attach to the outer edge of the eye on some level. Think of a flower blooming. This is essentially what her retinas are doing. So far, we've seen that her retinas are slowly opening and sinking back, but more scar tissue is appearing, which is why we've had to have multiple surgeries. To see light, you just need some part of the retina attached. You do not want to touch the retinas though, so this is where it gets very meticulous. The scar tissue and retina are the same color so he has to carefully decipher what is scar tissue vs. what is her retina, and there is always the risk of losing the eye all together. Not to mention, he is working on tiny eyes. God bless those hands. 

In January, Dr. Capone first did the Exam Under Anesthesia. He always does this so he can take a look at the anatomy of her eyes to decide if it is the right decision to operate. He came out to tell us that surgery was a go, and he was elated with what he had seen her eyes do from the first surgeries in October. When he actually went in to operate, though, on her right (better) eye, he thought we had won the battle but lost the war. Her retina was opening and sinking back as much as they could have hoped for, but he could now see that there was no blood flowing to the retina; meaning the retina was underdeveloped and she would never see light. The Fellow asked Dr. Capone why he wasn't stopping there. Something in Dr. Capone had to keep going. By the grace of God, Dr. Capone kept going. An hour and a half later, blood vessels appeared. When Dr. Capone came out after the surgery to let us know how it went, even he had goosebumps. The smile on his face gave me an indescribable feeling. No other doctor would even operate on Presley initially because her eyes were so damaged and thus deemed inoperable, and we are certain no other doctor would ever spend that kind of time clinging to hope like Dr. Capone did. If he had stopped, she would live in darkness, and we wouldn't be where we are today. He does not give up on these kids until it is not safe to continue. He is a true servant of God, and we will never be able to thank him enough. He is a special, special man.

He always operates on the better eye first so he can learn before he tackles the harder eye. What a humble doctor. Even with his experience and expertise, he admits he can always learn more. The surgery on her left eye two days later went about the same as the first but the left eye didn't have as much blood flow...but there was blood flow. The catch after the second surgeries was that even with what her eyes were showing and giving him, Dr. Capone had no way of knowing if they were developed enough to see light. The blood flow was a great sign, and obviously crucial, but he still didn't know if they had all the "tools" needed. But he was optimistic. With what he was able to do in the second surgeries, he felt confident that her retinas should attach on some level within three months. This was already a miracle that her eyes got to this point from where we started regardless of the outcome. Dr. Capone even told us, with a huge grin on his face, to expect a very pleasantly surprised and happy Dr. Abbey at our one week post-op in Dallas. He was celebrating with us. Even if we didn't get light, her eyes were now in a position where she would be a great candidate for gene therapy if one comes available for LRP5 within her lifetime. 

So we returned home to let her eyes heal and wait and see if we saw any reaction to light between February and March. It sounds a bit harsh, but we would shine a light every day in her eyes. There was absolutely no consistency. Some days we would start running for the champagne to celebrate and then would say lets try one more time....then nothing. When we went for our one month post-op in Dallas, Dr. Abbey agreed it was inconclusive. They were looking for her to squint which she definitely was not doing, but she would at times appear to get mesmerized by it and be super still (and this girl always likes to be moving). My mama instinct was telling me she did see light. I didn't know how well, but I truly believed she could see light. Dr. Abbey then referred us to UT Southwestern to have a VEP (Visual Evoked Potential) done. This testing is rarely used and come to find out is not entirely conclusive. They placed electrodes on Presley's head (pictures below) which recorded if her brain was receiving light. The results showed that there was a response in the right eye and no response in the left. What both Dr. Abbey and Dr. Capone have said is that this test does not quantify what she is seeing or how strong. You need to technically be still and keep your eyes open for the testing to be accurate. What this test does tell us is that her eye is talking to her brain (at least in the right eye) which is HUGE. Dr. Capone is not counting out the left eye yet. We know she sees light now for sure in the right eye. We don't know if that means she can tell a lamp is on or if it needs to be all the lights in the room on for her to see it, but we are celebrating light in whatever form that is!

I'll be honest, this Christmas season was especially hard. Trusting God takes on a whole new meaning when something like blindness happens to your child. Every church event or service we went to over the holidays seemed to put an emphasis on God bringing us out of darkness and into light. My family Christmas tradition is to attend the Gift of Christmas at Prestonwood Baptist Church which is where we grew up going. We've gone every single year since I can remember. This year, they changed it up a bit in how they told the story of Christmas and there was a particular emphasis on how we live in darkness until God brings us into the light and how you can't see in darkness. It felt cruel. There Michael and I were sitting with our completely blind, innocent four month old baby in between us who was living in darkness. Then a couple weeks later, the Christmas Eve candle light service at Watermark. Again, the same thing. I couldn't hold it together here. There I stood with my precious baby at my feet while Michael consoled me as I cried. My baby wasn't literally living in darkness because she was more of a sinner than my sister's baby. But she was living in darkness. I certainly don't expect churches to be overly sensitive to what every single person is going through, it was just unfortunate timing as I was still very fragile and very much still grieving. We serve a mighty God though and miracles do happen. Only 10% of the blind population see nothing at all. Presley is no longer among that number, and we are ecstatic. We were initially given a 0% chance at getting light perception. Dr. Capone gave us a 10% chance at best. It is a special thing when you get to be a part of blowing even the most skilled and educated doctors' minds. Happy tears all around. 

We head back to Detroit at the end of April for an Exam Under Anesthesia with the possibility of surgery depending on how her eyes look. He may operate on one, both, or neither. We have no clue until he gets in there. This does not get easier, and I am already getting anxious thinking about it. Please pray for strength for Michael and I. We trust Dr. Capone and are thankful we can rest knowing she is in the most skilled and caring hands. 

Presley is developing very well and has overall been happy during her one hour therapy sessions on Mondays. Her personality is coming out, and she could not be sweeter. Michael facetimes us every spare minute he has at work because he cannot get enough of her. She is so full of joy--I mean, have you seen that smile? She smiles with her entire face, and it is the absolute best.

Presley, I hope you know how much you are loved. I hope you know that you are not less because you are different. I hope you know you are capable of doing anything you set your mind to. I hope you know that your lack of vision does not define you. I hope you know that you are perfect because you are you. I hope you know that I am a better mom and a more empathetic person because of you. I hope you know that your dad and I will always be your biggest fans. I hope you know how much you changed our world for the better. I hope you know that we believe in you. You, sweet baby, are everything. 

Lifelines

The Lord provides. 

We've had an overwhelming amount of people reach out to us who are walking through similar journeys. Kimberley Mundy, a mom of two young blind children diagnosed with LCA (who live near us!), recently said to me that she certainly doesn't wish this on any child, but it is nice to know they aren't alone on this journey. This could not be more true. Michael and I have an incredible support system, but we needed people that were living it daily like we were. These people have become my lifelines.

One couple's letter to us early on hit close to home and had us both in tears. This family was no stranger to me though. Alex and Mary Beth Buck were good friends of my parents at SMU. They've stayed in touch so we've grown up knowing their family. They have three kids. Their second daughter, Adlaine, was diagnosed with Autism at an early age, and their youngest son, Eiler, was diagnosed with a rare neurological disorder at birth; an unexpected diagnosis as well. My sisters and I have always admired them and have talked for years about what amazing parents they are. The Bucks don't let any limitations a doctor or society might place on their kids because of their diagnosis hold them back. Eiler (now 19) has pretty much blown every doctor's prediction out the window for what they saw for his life; including that he wouldn't live past his first birthday. They are the most positive, fun, and loving parents. Their words to us were so honest and beautiful at a time when we needed it the most.

I've said it before, but I was born to be a mom. I was the kid playing "house" at an age I'm embarrassed to admit. My senior superlative in high school was, "most likely to be a soccer mom." That's what I always thought I'd be. A soccer mom. Not a special needs mom. It took a lot of tears and questioning to accept that this road might be better than the one I had planned for myself. I now know I've been admiring the Bucks for years for a reason. They have paved a beautiful path for those of us faced with a life-changing and unexpected diagnosis. They give me hope.

----------------------------------------------------------------------------------------------------------------------------------------------------------

When Presley was just two weeks old, my aunt, Vicki Gillespie, was talking to a nurse she works with, Cindy Asche, about Presley. Cindy's jaw dropped and went on to tell my aunt that her good friend works with a little boy in Frisco who she thought also had the same rare eye disease and was blind. They couldn't believe it. Cindy reached out to her friend who immediately wanted to help us in any way she could and told Cindy to pass on her contact information so I could reach out to her when I was ready. 

I was ready. Considering Michael and I didn't know anything about blindness or know a single person that was blind, I didn't want to waste any time reaching out to someone who works with visually-impaired children and could help. We were completely devastated and scared for Presley's future. Getting in contact with Shannon Kilburn, a Vision teacher in Frisco, was the turning point for us. She was an answered prayer before I even knew what to pray for. She sent me the sweetest email back encouraging us and giving us a wealth of information. She saved us hours of stressing over research and phone calls. We are SO thankful to my aunt and Cindy for connecting us to Shannon so early on. It was the best thing that could have happened to us.

Our plans had always been to live in our M Streets house until Presley was in kindergarten or we outgrew it and then move to where we wanted our kids to go to school. Early Childhood Intervention (ECI) will start working with kids like Presley immediately. As of now, Presley needs a Vision Teacher and Orientation and Mobility Specialist, which is provided free through the school district. I had just had a baby, my baby had just had an eye surgery on each eye, and now I needed to find a house in a district that has the best services for children like her. This easily could have been overwhelming and stressful. But it wasn't. Shannon initiated and researched districts we were interested in for us. She didn't even know us, but she was going above and beyond for us. 

She also told me about the little boy she works with, Ollie Park, and his family. Ollie was also born blind and diagnosed with FEVR as a baby. The fact that this family was living in Frisco--just 30 miles from us--was truly a miracle. Michael jumped into every FEVR/blind parent support group he could find on social media, but most people with our diagnosis (there aren't a lot of us) had FEVR in one eye only and thus had some (if not all) usable vision in the other. Our doctor in Detroit had told us, "we were an unusual case of a rare disease." Try wrapping your head around that. FEVR in itself is rare; FEVR causing bilateral retinal detachment from birth is even more rare since neither parent is blind. This family could have been anywhere in the world. But they were in Frisco, Texas. Insert praise hands. Shannon gave me Ben and Mimi Park's contact information and said they would love to talk to us and help in any way that they could. 

Mimi and I talked on the phone when Presley was three weeks old. She was real, encouraging, and incredibly supportive. She told me that she was there for me whenever I needed. If I needed to cry/vent/ask questions/meet for coffee, she was available 24/7. It was like a ton of bricks were lifted off my shoulders in a second. She's also as witty as they come and has a great sense of humor. While talking to her, I learned that Ollie also saw the same doctor in Detroit and now has light perception as a result of his surgery. Mimi told me if anyone could do anything, it was Dr. Capone. We are in the best hands. 

"Bumps and bruises" has been Ben's motto since Ollie was diagnosed. They do not hold back on anything just because Ollie is blind. He experiences everything his three sighted older brothers do. As a result, he is right on track with his same-aged peers and has such a good understanding of the world around him. 

A week before Christmas we got together with the Kilburns and Parks. It was the best day. After all, I consider them family now. I had gone to lunch with Shannon and Mimi about a month before and talk to them regularly, but this was the first time for Michael to meet them and for us to meet their families...and the man of the hour, Ollie. While we (and family and friends--sorry Mimi) have all done our fair share of stalking Ollie videos, we were finally meeting the little boy who has given us so much hope. To be honest, we were nervous. Insanely excited, but nervous. We, like most of you reading this, had never interacted with a blind person before (other than our baby). Any nerve I had went away the second he walked in, and I felt foolish for even being nervous. It was like I was talking to any other child. He is just like his brothers (his ridiculously sweet and polite brothers). He just experiences things differently because he can't see. He was full of questions and wanted to hold "Baby Presley" the entire time. What a beautiful, special picture that was. He is hilarious and one of the happiest kids I've ever seen. Meeting him far exceeded any expectations we had. We talked about it for the next 24 hours--with huge smiles on our faces. Thank you Ben and Mimi for sharing him with us. This kid is going places.

While Frisco Texas was never on our radar of places to raise our family, this is where the Lord has called us. We only moved two weeks ago and know this is where we are supposed to be right now. Our nextdoor neighbor, Brianna Lindholm, is already my new favorite person and has been so good to us. Oh, and when I met her she told me she has family members that were blind and she's good friends with Mimi and the Park family. She also gets severe migraines--for those of you that have grown up with me and been out at a restaurant where I am embarrassingly holding a glass of ice to my head and look like I am about to get sick because I was tired of them keeping me in bed, you know these are no joke. It can be hard for people that don't get migraines to understand how debilitating they are. If the way we got this house wasn't enough of a sign we were meant to live here, she is. 

When our realtor (shout-out to Tim & Ashlee Troop for selling me on this neighborhood) sent over a list of houses for sale, I got excited because I liked most everything about this one particular house. I told him I wanted to see it, and he was going to try and set something up for two days later. I even drove by it the next day and peeked in the windows (new build, not creepy). I called Michael after I drove by it and told him that I thought I had found our new home. It was on a quiet street with a large park, walking trail, and amenity center with a community pool across the street where they have holiday parties, concerts, etc. A block to the left would be a brand new elementary school and park. I could picture it. More importantly, I could picture Presley running around experiencing life and gaining her independence there. Come to find out that night, the house went under contract the same day that I found it. Emotional me, cried, really cried. We asked if we could put in a back-up offer but the contract was already in, and they were not taking back-up offers. They said I could email them our information and if for some weird reason something fell through, they would let us know. I emailed our story and received a response almost immediately back. The realtor was extremely empathetic and said she wished she could do something, but her hands were tied. Well, not even three days later, I got an email that the people suddenly got cold feet. She could not get us out of her head, and at the first sign of them wavering, she told them she would continue to show the house if they couldn't commit. They backed out, we went to see it the next day, and the house was ours. It all happened so fast we were a little nervous but this was clearly meant to be our house. I even started crying with the realtor...and made her cry. No shortage of tears over here. Whenever I start to doubt God, He steps in--in big ways. God is always good.

We are so excited to have Shannon start working with Presley as her Vision teacher--I wasn't sure if this was going to be a possibility or not so to say we are excited is really the understatement of the century. She will be coming to our house once a week to work (okay play) with Presley while she is a baby and will continue to do so until she is three. Presley will then go to a special pre-school and then our goal is to mainstream her in Frisco schools where Shannon will continue to work with her. Shannon is a huge blessing. Having to schedule weekly "therapy" sessions because your child will learn differently is not easy. It's not easy to open your home up to someone under these circumstances; especially when you are an introvert like myself. It is easy though when it is someone like Shannon. She is not just my daughter's Vision teacher. She is my friend, which makes all the difference in the world.

I still get sad for Presley, but I would not trade this experience for the world. Michael and I both grew up living in a bubble. I went to Trinity Christian Academy from K-12th grade and then went on to Texas A&M with over half my graduating class. Michael grew up in Colleyville and then went to Abilene Christian where his family has a huge presence. His 10 best guy friends from elementary school are still his best friends to this day. This experience has opened a door to a whole new world for us. People like us, and people different than us. It is so beautiful and has already taught us so much. I've lost count of how many times we've looked at each other and said, "they are just really good people."

2016 was the hardest and best year of our life. We're starting the new year stronger and better versions of ourselves. Happy 2017 friends!

“I like to think that one day you’ll be an old man like me talkin’ a young man’s ear off explainin’ to him how you took the sourest lemon that life has to offer and turned it into something resembling lemonade.”

— This Is Us

Hope

We got back from Hawaii on Sunday, October 2 and then were off to Detroit on the 4th. The plan was for Dr. Capone to do the same procedure again, an Evaluation Under Anesthesia (EUA), to see if he would operate on her. We were hopeful yet realistic given the severity.

Enter Dr. Capone. That 30 minute procedure felt like an eternity. Just like in Austin, Dr. Capone came and got us and took us back into a room. He had his poker face on. We could not read him to save our life. I was shaking. We wanted to hear so badly that he wanted to do surgery to try for light perception and that there were no severe risks, but we also wanted him to be confident in that. We didn't want him to just say he would operate because we came all that way. 

When he first walked in he said, "this is interesting...have y'all noticed anything different about her eyes?" I immediately spoke up so proudly because I had! Her eyes look bigger! "Correct. You are exactly right. They are bigger." He didn't say it so enthusiastically though. We had been told her eyes would always be small so I thought it had to be a good thing. Wrong. He goes on to explain that her eyes had changed since he saw the images Dr. Harper took a month prior. (Remember we were previously told they would not change at all). Just like at every appointment we had been to thus far, he drew pictures of what an eye should look like and then what Presley's looked like then and now. Within these few weeks that we decided to wait to come see him, fluid had built up in the front of her eyes causing them to blow up like balloons. They had gone from being small for her age to being huge for her age. This resulted in pressure around her eyes which would lead to glaucoma and damage the optic nerve. Keeping the optic nerve healthy is important for any technological advances in the future. We would never have caught this if we had not come to Detroit.

On the flip side, cue the tears. Every picture previously drawn by a doctor showed Presley's retinas completely detached and folded over each other like tissue paper in the front and back of the eyes. This time, his marker starts drawing it open instead of closed in the front of the eyes. This is when we both looked at each other and lost it. Before he could say the words, we knew what it meant: her retinas had opened some. The tears were flowing. Small victories. The fluid that had led to the pressure had also caused her retinas to open some naturally on their own. He absolutely wanted to do surgery and said there was more of a risk not to do surgery than to do surgery. This man is on another level. While he is brilliant and incredibly gifted, he is also genuine and just a good-hearted man. He had blocked off the majority of his day in case we were both in agreement to try surgery. We felt at complete peace about the surgery and were so thankful we came. God's perfect timing. Off he went to begin operating on Presley's right eye.

Because of the damage, he had to go through the front of the eyes so he had to take her lens and parts of her iris. This was honestly hard for me because her eyes do look different. Working or not, her eyes have always been my favorite feature. She has the cutest little eyes, just like her daddy. Much to my surprise, the recovery from eye surgery is not that bad. We had planned to stay overnight at the hospital after each surgery but they told us we didn't have to. We were like little kids on Christmas morning. We got to leave with her right after she woke up and go relax in beautiful Detroit. Okay, so maybe not beautiful, but a nice, big Holiday Inn Express hotel room in Detroit feels like paradise compared to staying in the hospital. 

Sitting in a children's surgical waiting room will really humble you. We saw tears of joy and tears of pure exhaustion, frustration, and hopelessness. Families with kids that have not known a home outside of the hospital. Families with kids that cannot eat, drink, or walk on their own. Families that return to PICU after another surgery gone bad. Families with kids whose vision or hearing is restored. You immediately feel connected even without a single word. You feel like you've never felt before. You would give anything to trade places with your child. While there is sadness and failure, there is also hope and success. On the day of Presley's second surgery, Michael had gone to get food for us and it took everything in me to not jump up and give this one dad a hug. I was sitting in the corner trying to mind my own business (okay maybe I was eavesdropping) when the doctor came out to give an update on his daughter. I don't know all the details, but she was losing her vision at a young age. The doctor's face lit up when she came out. The surgery had gone much better than expected, and his little girl was going to be able to see fully again. He LOST it. And so did the emotional blonde in the corner. He was absolutely precious and could not sit still. He kept asking when he could go hug his daughter. Looking back, I should have just gone and given him a hug but that was just too much for my introverted self. Instead, I celebrated quietly with him. All the feels. The look on his face is one that I will certainly never forget.

When we met with Dr. Capone before Presley's first surgery, he had told us that the anatomy of her eyes was exactly the same so the surgeries would be identical. On Friday, however, he came out an hour and a half earlier. We were surprised to see him, and he looked just as surprised. Once he got in there, he was pleasantly surprised to see that this eye was not nearly as bad as her right eye. More hope. For now, we are praying and hoping for light perception with guarded optimism.

We will be going back to Detroit in January for another surgery on both eyes. In the meantime, Dr. Capone is comfortable with Dr. Abbey monitoring her in Dallas between surgeries because Dr. Abbey trained under he and his partner in Detroit. Huge praise. Otherwise, we would have had to stay in Detroit longer and return for follow-up appointments. It came as no surprise to us when we found out Dr. Abbey trained up in Detroit. These men are on another level and are a godsend to us both medically and emotionally. 

Managing your expectations makes the smallest things feel like the biggest victories. Finding a doctor like Capone was a victory. Draining the fluid before she got glaucoma and her optic nerve was damaged was another victory. Regardless of any light or vision we may or may not get, we can be at peace with that. Presley is going to live a happy, amazing life and will have all the tools she needs to succeed--this momma promises you that! 

We have already connected with families on similar journeys (post to come soon on these incredible people) whose kids are living normal, happy lives and doing everything sighted kids do. We would not be in the place we are without them. Mimi Park told me last week we were now a part of her family. It's true. We are forever united because they have walked through our shoes. They understand without you even having to explain a thing because they have lived it daily too. When we first found out she was blind, I was a mess. I could not stop crying and worrying about her future. While I certainly have my moments where my heart breaks for her, I get chills now thinking about what an inspiration she is going to be. Let's move those mountains baby girl. 

Hawaii 6-0

Before Presley was born, we had planned my mother-in-law's 60th birthday trip to Hawaii. She turned 60 on September 13, but we scheduled it for a few weeks later so Presley would be around one month old. After returning home from Austin with our one week old to start our new normal, my mother-in-law wanted to postpone the trip out of sensitivity to us. For those of you that don't know Kathy Halbert, also known as Minnie, this woman is incredibly selfless. Selfless is one of those adjectives that you really can't use often to describe someone, but Minnie is just that; she is selfless in every aspect of her life. She deserved to be celebrated. 

A few days after returning home from Austin, Michael and I began to have a change of heart and couldn't give up on our baby yet. Through our research, we kept coming across some doctors up in Detroit who have done extensive research on FEVR. We called our Austin doctor again, who was still taking our calls without hesitation, and expressed to him we would like to go up to Detroit for a second opinion. While he stood by what he previously told us, he understood how we felt and sent Dr. Capone the images he took while Presley was under anesthesia. Dr. Harper got back with us within a few days that Dr. Capone agreed with his diagnosis but would be happy to see us and take a look at her eyes himself. Knowing we had this birthday trip planned, we asked him if it was time-sensitive to get up to Detroit. Of course, Presley's health was our first priority, but we wanted to see if we could make it work. Since she was completely blind, he reiterated that nothing was going to change so waiting a couple weeks wasn't going to matter. 

We were able to convince my in-laws to reinstate the trip and had a great week celebrating my mother-in-law.

The One In Two Million Baby

Home sweet home. It was finally our turn to sit on the couch all day and love on our baby like most new parents get to do. We could not cuddle her enough. We also became professional "googlers" trying to learn as much as we possibly could about this rare disease and how to raise a blind child. Considering no one in either of our families is blind or has had any vision issues for that matter, we were in serious denial that this could be hereditary. For family planning purposes, we had our blood drawn, and Michael's dad was gracious enough to run our bloodwork through his labs in Phoenix. Family, co-workers of Michael, and complete strangers were working and researching around the clock for us. We don't take this for granted and cannot say thank you enough.

I'd go into detail about everything I've learned about genes and mutations except I still get confused--and Michael has explained it probably 100 times to me. Let's be real, I was born to be a mom, so I'm good at---well, mom things. To dumb it down (because this is the only way I know how to explain it), Presley has an autosomal recessive LRP5 mutation; meaning she got one from Michael and one from me. The perfect storm. This is extremely rare. Michael and I just happened to find each other & both be carriers of two different mutations on the same gene and both pass it down to our precious baby. Because it is recessive (meaning Michael & I aren't showing any signs of FEVR), we both have to pass it down for it to effect our kids, and the severity can vary. This means there is a 25% chance any future kids could also be impacted. Michael and I both received a good gene from either our mom or dad so our bodies naturally chose the good. In Presley's case, she received both of our bad copies which resulted in FEVR. 

Are we actually related somehow and didn't know it? We've been told we look like siblings and have very similar personalities so I've joked about this a time or two. Don't worry, we aren't from Arkansas. We're just the one in a (two) million.  

Diagnosis

On Sunday the 28th, the Pediatrician came by to do her final check-up to discharge us from the hospital when she noticed that she wasn't getting the red reflex in either of Presley's eyes. She said it could be congenital cataracts or her eyes could still just be swollen from the delivery. She gave us the information of an opthamologist to get checked the next day. After having a healthy pregnancy with no signs of anything wrong and then a smooth and easy delivery, we honestly were no where near prepared for the news we were about to get.

We were sent home from the hospital that afternoon and then at 10am the next morning, we went to see an opthamologist. She told us that Presley had cataracts in both eyes and wanted us to see a Specialist at Children's immediately. When a doctor tells you that they are going to go call a Specialist to get you in right away, you know it is not good. She left the room, and we both started bawling. When she came back in, she gave us the Specialist's information and told us best case scenario was that Presley would have cataract surgery in both eyes. Michael then asked what the worst case was. She got uncomfortable and said worst case is she cannot see. Our hearts sunk.

We then headed to Children's in Plano which I will spare you the details of this visit because the doctor had the worst bedside manner e v e r. We could not get out of there fast enough. To sum up this visit, we were told Presley's eyes were severely damaged, and she either had late stage Retinoblastoma, a dangerous cancer to the eyes, or a rare disease known as PHPV which causes blindness and has little to no treatment. She then referred us to see a Retina Specialist, but she couldn't get us into one for ten days. That was not acceptable to us, but I was so over this woman that I just wanted to get out of there.

Enter my sister, Brittany, to save the day. We texted our families on the way home from Children's that the next step was to see a Retina Specialist to look more closely at the back of her eyes to try and figure out a diagnosis and rule out cancer. Brittany works at Scottish Rite and texted me within minutes that she was reaching out to doctors there to see if they knew of any Retina Specialists. Before we even got home, a doctor at Scottish Rite had reached out to his friend, Dr. Spencer, who is a Retina Specialist in Dallas. He was more than willing to see us, however, he was out of town that week but said he could get us in to see his partner the next morning. I'm no eye expert...well now I am...but after looking at the ultrasound at Cruella's office, I knew that was not even close to what eyes were supposed to look like. Getting in to see someone so quickly was a huge relief. We just needed answers. We are forever grateful to my sister and these strangers for doing whatever they could to help us. So many good people...except Cruella of course. 

First thing on Tuesday the 30th, we headed to Texas Retina in Dallas to see Dr. Abbey. Having been told your daughter could be blind to being told your daughter may have a late stage cancer, your emotions are all over the place. We were crying and praying in the waiting room that she just didn't have cancer. We knew nothing about blindness nor did we know anyone that was blind, but we could handle that. Just please don't let it be cancer. We could not lose her.

Enter Dr. Abbey. Picture early 30s, easy on the eyes, very muscular man. Oh and boy was he sharp. Within 30 seconds of looking at her eyes, he said she did not have cataracts and that he believed she had a very rare genetic disease called Familial Exudative Vitreoretinopathy (say that five times fast) also known as F.E.V.R. He did not think it was Retinoblastoma. The ultrasound then confirmed we were not facing cancer. Hallelujah. He told us that he could operate on her, but he personally did not feel comfortable given how little she was. He referred us to a Pediatric Retina Specialist in Austin who he called directly so we could get in as soon as possible. I cannot say enough good things about Dr. Abbey. He is brilliant, confident, and was good in a crisis. I felt weirdly at peace leaving his office. After having the worst experience the day before, he was the right man to deliver the news to us that Presley was in fact blind, however, he also did not want us to give up hope. God is good.

Enter Dr. Harper. We drove down to Austin the following morning, the 31st, and met with Dr. Harper. My older sister, Lauren, insisted on riding with us to help with logistics and make sure I was getting enough food and water since I did just give birth a few days before and was nursing. Sisters are something special. Dr. Harper looked at Presley's eyes and was very straight forward with us that the prognosis was not good. He agreed with Dr. Abbey that this was likely Stage 5B (the most severe) F.E.V.R. He wanted to look at her eyes under general anesthesia to see if he recommended doing surgery but was very honest with us that the chance of getting her even light perception was not good. He was extremely empathetic and even gave Michael his cell phone number to call him anytime if we had questions. He answered every time we called or quickly called us back no matter the time of day or where he was. Like I said earlier, so many good people. We scheduled the procedure for two days later on that Friday. Leaving this appointment was probably our lowest point: confirmation that she was completely blind and that the odds were not in our favor. This was such a cruel diagnosis. We were completely hopeless and heartbroken. Lauren picked us up, and we all just sat in the parking lot and cried before we gathered ourselves and headed back to Dallas.

Michael and I drove back down to Austin the following afternoon to spend the night because we had to be at the hospital at 5:45am on Friday morning. The procedure took about 30 minutes. Dr. Harper took us back into a room and told us that both retinas were completely detached in the front and back of the eyes and folded over like tissue paper. He believed this took place during my first trimester due to a bad gene. We were completely shocked and somewhat in disbelief to hear that we carried a gene capable of this. More on the genetic diagnosis to come. Given the damage, he was adamant that surgery was not a good option and he wouldn't operate on her. We were told her eyes would not grow so they would always be small and because she was the most severe case, there would be no further damage to the eyes. Hearing he did not recommend surgery broke our hearts all over again, but we trusted this man and agreed we didn't want to put our baby through trauma for no outcome. Both our parents and my sister, Brittany, came down to be with us that day in Austin as we had to stay overnight at the hospital for Presley to be monitored because she was so little. Our families have been incredible throughout this whole experience, and we really don't know how we would have made it through without them. 

On Saturday, we loaded up our one week old baby and headed home to start our new normal. It had been a roller coaster of emotions, but we were ready to accept this, or so we thought...

To Be Continued

August 26, 2016

At 3am on Friday, August 26, I woke up to my water breaking. I excitedly woke Michael up: Michael, Michael, Michael (he's one hard sleeper) my water just broke!! He then jumped up like the house was on fire. No way, what do we do now!? Me: I don't know! Let me go get my packet from downstairs. Real life people. I only had 10 months + 1 week, thanks Pres, to prepare for this moment but there we found ourselves staring clueless at each other. If your water breaks girls, you call your doctor and go to the hospital.

When we got to Baylor, I wasn't having any contractions so they had me walk around for a couple hours to try and get them going. By 7am the contractions were in full force. I got my epidural (praise Him) around 10am and was ready to push around 12:30pm. While everyone was preparing and talking so casually (this is their day job after all), we were sitting there giddy and crying. We were about to finally meet this little human that we created, and we were beyond excited. We prayed together and then around 1:30pm my doctor came in. After only twenty minutes of pushing, Presley Lynn Halbert entered the world weighing 7lbs 1oz, 21 inches long. Our lives had just changed forever in the best way possible.

Those that know Michael know he is extremely sweet and sentimental. The nurses could not get over how adorable he was. He was just sobbing staring at Presley with the biggest grin on his face. Presley sure hit the jackpot with him as her dad. Michael has always been one of those guys that has been terrified of newborns. He never wanted to hold them for fear that he would "break them." That fear left him the second he saw his little girl. He could not and still cannot get enough of her. #daddysgirl

Presley Lynn, you are the best thing that has ever happened to us, and we love you more than words can express.